Curing Cancer with Your Cell Phone: Why all Sciences are Becoming Computing Sciences David Evans http://www.cs.virginia.edu/evans Computer Science = Doing Cool Stuff with Computers? College Science Scholars.
Download ReportTranscript Curing Cancer with Your Cell Phone: Why all Sciences are Becoming Computing Sciences David Evans http://www.cs.virginia.edu/evans Computer Science = Doing Cool Stuff with Computers? College Science Scholars.
Curing Cancer with Your Cell Phone: Why all Sciences are Becoming Computing Sciences
David Evans http://www.cs.virginia.edu/evans
Computer Science =
Doing Cool Stuff with Computers?
College Science Scholars 2
Toaster Science =
Doing Cool Stuff with Toasters?
College Science Scholars 3
Computer Science
• Mathematics is about declarative (“what is”) knowledge; Computer Science is about imperative (“how to”) knowledge • The Study of Information Processes – How to describe them Language – How to predict their properties Logic – How to implement them quickly, cheaply, and reliably Engineering
College Science Scholars 4
Most Science is About Information Processes Which came first, the chicken or the egg?
How can a (relatively) simple, single cell turn into a chicken?
College Science Scholars 5
Agenda
• Three Big Ideas: – All Computers are Equally Powerful – Programs are Data, Data are Programs – Many Surprisingly Different Problems are Equally Difficult • One Open Question – Is a machine that can always guess correctly able to solve problems a normal machine can’t?
College Science Scholars 6
“Computers” before WWII
College Science Scholars 7
Mechanical Computing
College Science Scholars 8
Modeling Pencil and Paper
...
# C S S A 7 2 3 ...
How long should the tape be?
“Computing is normally done by writing certain symbols on paper. We may suppose this paper is divided into squares like a child’s arithmetic book.” Alan Turing, On computable numbers, with an application to the Entscheidungsproblem, 1936
College Science Scholars 9
College Science Scholars
Modeling Brains
•Rules for steps •Remember a little “For the present I shall only say that the justification lies in the fact that the human memory is necessarily limited.” Alan Turing
10
Turing’s Model
...
# 1 0 1 1 0 1 1 1 0 1 1 0 1 1 1 # ...
Start Input: # Write: # Move: Input: 1 Write: 1 Move: 1 Input: 0 Write: 0 Move: 2 Input: 1 Write: 0 Move: Input: 0 Write: # Move: 3
College Science Scholars 11
Universal Machine
Universal Machine A Universal Turing Machine can simulate any Turing Machine running on any Input!
College Science Scholars 12
Church-Turing Thesis
• All mechanical computers are equally powerful* *Except for practical limits like memory size, time, energy, etc.
• There exists a Turing machine that can simulate any mechanical computer • Any computer that is powerful enough to simulate a Turing machine, can simulate any mechanical computer
College Science Scholars 13
What This Means
• Your cell phone, watch, iPod, etc. has a processor powerful enough to simulate a Turing machine • A Turing machine can simulate the world’s most powerful supercomputer • Thus, your cell phone can simulate the world’s most powerful supercomputer (it’ll just take a lot longer and will run out of memory)
College Science Scholars 14
Recap
• All Computers are Equally Powerful • Programs are Data, Data are Programs • Many Problems are Equally Difficult – But no one knows how difficult!
College Science Scholars 15
A “Hard” Problem?
College Science Scholars 16
Generalized Pegboard Puzzle
• Input: a configuration of cracker barrel style pegboard (of any size)
n
pegs on a • Output: if there is a sequence of jumps that leaves a single peg, output that sequence of jumps. Otherwise, output false.
Is this a “hard” problem?
College Science Scholars 17
Solving Problems
• A solution to a problem instance: given a pegboard configuration, here’s the sequence of jumps • A solution to a problem: a procedure that (1) always finds the correct answer, and (2) always finishes.
College Science Scholars 18
“Brute Force” Solvers
• Enumerate all possible answers – Every possible sequence of jumps • Try them all until you find one that works – Simulate the jumps • This works for almost all problems!
• Problem: how long does it take?
College Science Scholars 19
1200
Problem Solving Time
1000 800 ~ 2
n
600 ~
n
3 400 200 0 1 2 3 4 5 6 7 8 Problem Input Size 9
College Science Scholars
10 ~
n
20
70000
Increasing Problem Size
~ 2
n
60000 50000 40000 30000 20000 10000 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 ~
n
3
College Science Scholars 21
1200000 Tractable and Intractable Problems 1000000 800000 600000 400000 “intractable” “tractable” 200000 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
I do nothing that a man of unlimited funds, superb physical endurance, and maximum scientific knowledge could not do.
– Batman (may be able to solve intractable problems, but computer scientists can only solve tractable ones for large n)
College Science Scholars 22
time since “Big Bang” 2032 today
This makes a huge difference!
~ 2
n
1E+30 1E+28 1E+26 1E+24 1E+22 1E+20 1E+18 1E+16 1E+14 1E+12 1E+10 1E+08 100000 0 10000 100 1 ~
n
3 2 4 8 16 32 64 128 log-log scale
College Science Scholars 23
Back to the Pegboard...
• A brute force solution is easy...but on the pink line • Is there a tractable solution?
1E+30 1E+28 1E+26 1E+24 1E+22 1E+20 1E+18 1E+16 1E+14 1E+12 1E+10 1E+08 100000 0 10000 100 1 2 4 8 16 32 64 128
College Science Scholars 24
Deciding a Problem Is Hard
• “I tried really hard and still couldn’t solve it.” – Maybe the speaker isn’t smart enough – Maybe a few days more effort will find it • “Lots of really smart people tried really hard and no one could solve it.” • “It seems sort of like this other problem that we think is hard...”
College Science Scholars 25
College Science Scholars
Reduction
Input Trans former Output Trans former Pegboard Solver jumps Hard Problem Solver
26
Reading the Genome
College Science Scholars
Whitehead Institute, MIT
27
Gene Reading Machines
• One read: about 700 base pairs • But…don’t know where they are on the chromosome Read 3 TACCCGTGATCCA Read 1 Actual Genome Read 2 TCCAGAATAA ACCAGAATACC ACCAGAATACCCGTGATCCAGAATAA
College Science Scholars 28
Genome Assembly
Read 1 Read 2 Read 3 ACCAGAATACC TCCAGAATAA TACCCGTGATCCA Input: Genome fragments (but without knowing where they are from) Ouput: The full genome
College Science Scholars 29
Genome Assembly
Read 1 Read 2 Read 3 ACCAGAATACC TCCAGAATAA TACCCGTGATCCA Input: Genome fragments (but without knowing where they are from) Ouput: The smallest genome sequence such that all the fragments are substrings.
College Science Scholars 30
Genome Assembly Solver
ACCAGAATACC TCCAGAATAA TACCCGTGATCCA (~30M reads, ~900 bp) Input Trans former
College Science Scholars
Output Trans former Pegboard Solver jumps Genome Assembly Solver
31
What This Means
• We already know the shortest common superstring (genome assembly) problem is “hard” • The pegboard problem must also be hard, since we could use a solver for it to solve the genome assembly problem – Requires: we can build fast transformers that don’t increase the problem size exponentially
College Science Scholars 32
...
Non-Deterministic Machines
# 1 0 1 1 0 1 1 1 0 1 1 0 1 1 1 # ...
Start Input: # Write: # Move: 1 Input: 1 Write: 1 Move: Input: 0 Write: 0 Move: Input: Move: # Write: 0 4 2
College Science Scholars
Input: 1 Write: 0 Move: 3
33
Non-Deterministic Machine
• Everytime there is a choice, it can guess the correct choice without looking ahead • If we had such a machine, solving Pegboard (or Genome Assembly, etc.) problem would be easy: – It can guess the solution one step (alignment) at a time
College Science Scholars 34
Big Open Question
Is a non deterministic machine able to solve problems that are intractable on a deterministic machine?
1E+30 1E+28 1E+26 1E+24 1E+22 1E+20 1E+18 1E+16 1E+14 1E+12 1E+10 1E+08 100000 0 10000 100 1 2 4 8 16 32 64 128 Seems obvious that the magic guess correctly ability should be useful...but no one knows for sure!
College Science Scholars 35
Recap
• “P vs NP” problem (one of the millennium prize problems) • Solving the pegboard puzzle is equivalent to solving genome assembly • With a non-deterministic machine, we could solve both • With a mechanical computer, we don’t know if a tractable solution exists (but can’t prove it doesn’t): We don’t know if checking a solution is really easier than finding it
College Science Scholars 36
Summary
• Computer Science is the study of information processes: all about problem solving • Many seemingly paradoxical results: – All Computers are Equally Powerful!
– Many Surprisingly Different Problems are Equivalent!
• And seemingly obvious open problems: – Is checking a solution is really easier than finding it?
College Science Scholars 37
Computer Science at UVa
• New Interdisciplinary Major in Computer Science for A&S students (approved last year) • Take CS150 this Spring – Every scientist needs to understand computing, not just as a tool but as a
way of thinking
• Lots of opportunities to get involved in research groups
College Science Scholars 38
My Research Group
• Computer Security: computing in the presence of adversaries • Recent student projects: – Proof that the Pegboard puzzle is hard (Mike Peck and Chris Frost) – Disk-level virus detection (Adrienne Felt) – Web Application Security (Sam Guarnieri) – N-Variant Systems: run variants of a program simultaneously (Sean Talts)
College Science Scholars 39
Questions
http://www.cs.virginia.edu/evans evans@cs.virginia.edu
College Science Scholars 40